Identification of the sex of Schistosoma mansoni larvae by PCR

© 2010 Christoph Grunau,

Extract DNA of a single cercariae using the protocol of Beltran et al. (2008) [Ref]. Do PCR with the QIAGEN multiplex kit.
Reaction mix (10 µl final volume):
  1. •5 µl of 2x QIAGEN Multiplex PCR Master Mix
  2. •1 µl of 10x Primer mix (1 µM of each sex specific primer, 2 µM of each control primer, 10 mM of Tris.Cl, 1 mM EDTA, pH 8.0)
  3. •1 µl of DNA
  4. •3 µl DNase-free water.
PCR program:
  1. •denaturation at 95 °C for 15 min
  2. •35 amplification cycles (94 °C for 30 s, 57 °C for 90 s, 72 °C for 60 s)
  3. •extension at 60 °C for 30 min.
Control primers (amplifies on male and female):
  1. •Rhodopsin-Forward : GACGGCCACACTAAAG
  2. •Rhodopsin-Reverse :  AGTAAAATGGTCACTGCTAT
Female specific primers (amplifies on female and not on male):
  1. •SmWSPP2-Forward : CTGTTTCGAATTTCACACTTCA
  2. •SmWSPP2-Reverse : CATTCACAGTTTGGCGAACA
                    
Ref:
Portela J, Grunau C, Cosseau C, Beltran S, Dantec C, Parrinello H and Boissier, J. Whole-genome in-silico subtractive hybridization (WISH) - using massive sequencing for the identification of unique and repetitive sex-specific sequences: the example of Schistosoma mansoni.  BMC Genomics, 2010 Jun; 11(1):387 [Free full text]

Beltran S, Galinier R, Allienne JF, Boissier J. Cheap, rapid and efficient DNA extraction method to perform multilocus microsatellite genotyping on all Schistosoma mansoni stages.  Mem Inst Oswaldo Cruz. 2008 Aug;103(5):501-3. [SciFLO]